circad | circRNAs associated with diseases

circ-IARS
Gene	IARS	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Pancreatic Ductal Adenocarcinoma	ICD-10	Malignant neoplasm of Pancreatic duct (C25.3)
DBLink	Link to database	PMID	30064461
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	HUVEC, Hs 766 T and Aspc-1 cells were obtained from ATCC
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCAACATTACAGACCGGTG Reverse CTCGAAGTTGGAAAGTGGAGTG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Li, J, Li, Z, Jiang, P, Peng, M, Zhang, X, Chen, K, Liu, H, Bi, H, Liu, X, Li, X (2018). Circular RNA IARS (circ-IARS) secreted by pancreatic cancer cells and located within exosomes regulates endothelial monolayer permeability to promote tumor metastasis. J. Exp. Clin. Cancer Res., 37, 1:177.